Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST300210
Clone ID OST300210
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST300210
Sequence
CGCCTTTTCTGAAGTTGTTTTAGCCGAGGAGAAAGCTACTGGGAAGCTCTTCGCAGNGAAGTGCATCCCGAAGAAGGCGC
TGAAGGGCAAGGAGAGCAGCATCGANAACGAGATTGCCGNGCTTAGAAAGATTAAGCANGAAAACATTGTTGCCTTGGAA
GATATTTATGAAAGCCCATAGCACCTGNTACCTGGTCATGCAANTTGTGTCTGGCGGAGAACTNTNCGANCGGATAGNGG
AGANGGGGTTTTACACAGAGAAAGATGCCAGTATTCTCATCCGNCAGGTCCTGGATGCCNTATNCTATNTNNACAGANTG
GGCATTGTGCACAGGGACCTCATGCCGNAGAATCTCTTATACTACAGTCAAGACGAGGNGTCCAAANTAATGATCAGTGA
CTTTGGCTNGTCGAAAATGGAGGGCAAAGGAGATGTGATGTCCACGGCCTGCGGGACCCNAGGNTATGTTTGCTCCGGAA
GTTCTCGCNCAGAAACCGTACAGCAAAGCTGC
Sequence Type mRNA
Unitrap ID UNI22331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5260265..5486822 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es