Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299972
Clone ID OST299972
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299972
Sequence
TGAGTCCCAGGACATGAAAGCCCTGCAGAGGAGCTAGAACAGTTTGCCAAGCTGCTGAAGCAGAAGAGGATCACCTTGGG
GTACACCCAGGCCGACGTGGGGCTCACCCTGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACCACCATCTGTCGCTTCG
AGGCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGCCGGCCCCTGCTGGAGAAGTGGGTGGAGGAAGCCGACAACAA
TGAGAACCTTCAGGAGATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCGAACTAGCATTGAGAACCGTG
TGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCTCCCTACAGCAGATCACTCACATCGCCAATCAGCTT
GGGCTAGAGAAGGATGTGGTTCGAGTATGGTTCTGTAACCGGCGCCAGAAGGGCAAAAGATCAAGTATTGAGTATTCCCA
ACGAGAAGAGTATGAGG
Sequence Type mRNA
Unitrap ID UNI13399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35646046..35647314 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024406 (Pou5f1) NM_013633 POU domain, class 5, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101893]

 
Come back to gene ENSMUSG00000024406


For any suggestions or comments, please send an email to unitrap@crg.es