Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299860
Clone ID OST299860
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299860
Sequence
TGAGCCTTTGCTTCCTTACTTTGCTGGAGCCCAGCATGCTGGAGTCAACATTCAAGCANACCAGGACTGTTGCCTCTTCC
TCCAGCTGCGNNTNTNTGTCTGCGCAGTTGCTTTGATCCATGTGGGCCGTCTTTGAGATTCCCTCCTCGAAAGCGCCCTC
AGCATGTCAGCAGCAGCGAAATCCCAAGTGCCGGAGGAGGCAGCNGCCTGGCTGCGAGGAAGAGCCCAAGGGAAAAACAC
TTCTCACTTGGGGGTCTCTATTTGGTCACCGAAGTGAGAAGATTGTCTTTACCAAAGGTGATGGCAGCCCAGAGGAGAGC
TTGCTCACTGTCACCATCACAGAGACCACTGTCATTGAGTCGGATCTGGGTGTGTGGAGTTCAAGGGCTCTCATCTACCT
CACACTGTGGTTCTTCTTCAGCTTCTGTACACTGTTCCTCAACAAATACATCCTGTCCCTGTTAGAGGGAGAGCCCCAG
Sequence Type mRNA
Unitrap ID UNI22338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154983946..154984418 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es