Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299722
Clone ID OST299722
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299722
Sequence
GGTTGAGACCCAGCTGCCGCAGGTACGCTGGGTGCCAGAATCGCCCACCTGTGGATGGGGGCAGCCAGGTGCCCACAGTG
CTGGACACCCGCCGTGCCTGCCGGCAGCCTCCACCCCCACGCCTTCTCTGGCACCCCTTCACTGTCCCCTGCATCCCCAC
CATTCCCCAGACACTGGATTTAAGGCACACACAGNTGTGAGATGACTTCACATCGACCCCTTGNGCAGTGACCCGGATGG
TGCCCCACCCACACATGAAGCACCCACAGCTCAGCTGCCACCCTAGGCAACTCCTCCGGTTTCCTATCACTCTGCTCCTG
ACCCGGGAGGTGAGAACAGGAAGCCCAGCCTTCAGCTCCCTTGGGAGTTTCCAGCCTCCCTCTTAAAGGCCACTAGGGTT
TCCAGATCCTATTTGAGAGTCTCCAGGCCTCCCCTGAAGGGTTCTAGCCACCACGCCCACAGGATTCCCATTAGGTTTTA
AAGCTTTC
Sequence Type mRNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74021816..74022303 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es