Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299559
Clone ID OST299559
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299559
Sequence
TGAGTACTGGCATAAAGCATGCTTTCACTGCGAGCCCTGCAAGATGACCCTGAACATGAAGAACTACAAGGGTTATGAGA
AGAAGCCTTACTGCAATGCACACTATCCCAAGCAGTCCTTCACCATGGTGGCCGACACTCCGGAAAATCTCCGCCTCAAG
CAACAGAGCGAGCTGCAGAGTCAGGTGCCGCCTACAAGGAGGAATTTGAGAAGAATAAGGGCAAAGGTTTCAGCGTGGTG
GCAGACACGCCTGAGCTGCAGAGAATCAAGAAGACCCAGGACCAGATCAGCAATATCAAATACCATGAGGAGTTTGAGAA
GAGCCGCATGGGGCCCAGTGGAGGAGAAGGGGTGGAACCAGAGCGCCGAGAAGCCCAGGACAGCAGCAGCTACCGGAGGC
CCACAGAGCAGCAGCAGCCGCAGCCTCACCATATCCCGACCAGTGCCCCCGTGTACCAGCAGCCCCAGCAGCAGCAGATG
ACCTCGTCCTATGGTGGGT
Sequence Type mRNA
Unitrap ID UNI13256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97668137..97695445 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es