Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299491
Clone ID OST299491
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299491
Sequence
TGAGTATTTGGTTTCTCTGGATATTTCTTCATTAAGACTTTAAAAATGTCATCCAAACAAGAAATAATGGATGACCAGCG
GTTCAGGCGGGTTTCAAAGGATCCCAGATTTTGGGAAATGCCAGAAAAGGAACGAAAAGTCAAAATTGACAAGAGGTTTC
CGAGCCATGTTCCATGATAAAAAGTTTAAATTGAACTATGCTGTTGATAAAAGAGGTCGTCCTATCAGTCACAGCACTAC
AGAAGACTTGAAGCGCTTCTATGACCTTTCAGACTCTGATTCTGATCTCTCTGATGAAGAAAGCAAAATACTCAGTCAGA
AGAAAGCGAAGCAGAAAAAAAAACA
Sequence Type mRNA
Unitrap ID UNI18241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 139993852..139994193 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045624 (Esf1) NM_001081090 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Esf1-001]

 
Come back to gene ENSMUSG00000045624


For any suggestions or comments, please send an email to unitrap@crg.es