Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299465
Clone ID OST299465
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299465
Sequence
ATGAGGGACCCTGTGAGTAGCCAGTACAGCTCCTTTCTTTTCTGGAGGATGCCCATCCCAGAACTGGATCTGTCGGAGCT
GGAAGGCCTGGGCCTGTCAGATACACCTACCTACGAGAGCAAGGATAGCAGCAGCGTTGGCAAAATGAACGGGCAGGCAT
CTGGGACGGAGCAGAAGAACCCTGAAGGTGACCCCCTCCTTGAGTACAGCACCTTCAACTTCTGGAGAGCGCCTATTGCC
AGCATCCACTCTGTCGACCTGGACTTGCTTTAAGGCCAAGATCTCTCTCCCACCCCGTACCTTCATTATCTTCCCTCTTA
AGTCCCTTCCTCTCTAAGCCTTCCACTTTAATCTTGTTCTCTTCCCTCTATTGTGCTGGTGGTGCTGATGAATCTGCCAA
TTGAAT
Sequence Type mRNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95023974..95024379 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es