Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299445
Clone ID OST299445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299445
Sequence
GACTGAGTTTGCAGGGGCATGGCTCCTGGTGGCTGTGGGCTCTTCGTGCCGCTTTCTTCAGGAGCAGGGACACCGAGCTG
AGGCCACCACATTGCACGCAGCTCCCCAGGGTGCAGCTATGGCTGTCAGCACCTTCCGAAAGCTAGATGGGATATGTTGG
CAGGTACTGCCAACTCTTTGAGAACACAGGGGTCCCTGGCCGCTTCTTGTTCCAAGTCTCACGGGCCCGTGGACCAGTGC
ATATGGTGGTTGCTGAGACTGACTATCAGAGCTTTGCCATCCTGTACCTGGAACAGGGAAGGAAGCTGTCTGTGAAACTA
TACGTCCGCTCACTGCCAGTGAATGACTCTGTCCTGGATGTGTTTGAGCGGCGAGTCAGGGAAGCCAACCTGACAGAAGA
TCAGATTCTTTTCTTTCCCAAGTATGGTTTCTGCGAGACTGCGGACCAATTACACATCCTGAACGAGGTGCCGCGATAAG
GCCATCTAGTGGAGAAGCTGTGGACAGTGGGCTACCCTCAGAGAGTT
Sequence Type mRNA
Unitrap ID UNI19894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25354282..25355497 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015083 (C8g) NM_027062 complement component 8, gamma polypeptide Gene [Source:MGI (curated);Acc:C8g-002]

 
Come back to gene ENSMUSG00000015083


For any suggestions or comments, please send an email to unitrap@crg.es