Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299210
Clone ID OST299210
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299210
Sequence
TGTGCCTGCCAGCCTGGGCCACAACCTACCTGCTCTNCATNGCCTTCAAAATANCACCATGAGCTGGAAACCTGTGGCNG
GACATCCCAAACTCAAACTGCATTACTGAGAGCAACACCATNCTCACTTTAGTGGCAGCTCCTTCTCCCACTCACTCATC
CTACAGANAAGGTGGAGAAGGTGGAGAGCGATGACACGGGACTGAGGAAGGATTGGAATTGATGCAAGCTCCAGGCTTTG
CTCCATTTTCTGAAGATTTACACATAGATACCTCTCAATGGGCAGTAGTCTTAAATATAGCTAATTTCTTAACTAATNAA
TTGATTCTGGAGTTTTCTTATNCTTTAAATGCTGCATAGTAGACTATCACTTGTAATTACTCTTGATTCCTTTTGAATTN
GGACTGTCAAATACAGTATTTCTGAACAGT
Sequence Type mRNA
Unitrap ID UNI22364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5730603..5731030 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039128 (Cdc123) NM_133837 cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc123-001]

 
Come back to gene ENSMUSG00000039128


For any suggestions or comments, please send an email to unitrap@crg.es