Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST299166
Clone ID OST299166
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST299166
Sequence
GACTGAGGGACGACCATTGCCAAATCNCNCTCAGTCCTGACCCCGGCNTGNTGCGNGCNTACCACACGGCGNAAGGTNAC
GNCAGCTGNNCCCNGACCTGATGTGTNCCCTTTNTGGTGGCGTGCTCNATGTNTGGCCACCACGCATNGGGNAANGCNNA
CATTCCTTNNGCANNAACCTGCTGTCGTACNCAACTATGAACACCANCANANTCCTGTCNNATGTNNNNCAGTGCAGNTC
CNTACAACTNGATNACTGCTGACAATNATATNNNGACGANACCNTACTNGACNTTGTCTACNGGTTGGNGNCTGGNCCTT
TTTACAGANGAAATGAAACGGCGACGGGACTTCTATGCAGCATACCCCCTGACAGAGGTCCCCAACGGCTCCAACGAGGA
CCGAGGCGAGGTCCTGGAACAGGAGAAGGGGGCTCTGGGTGACGACGAGATTGTCAGTCTTTCCATTGAGTTCTACGAAG
GCGTCAGGGACCGAGAGGAGAAGAAGAACCTCACGGAGAATGGAGATGGGGAC
Sequence Type mRNA
Unitrap ID UNI22367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97553181..97554879 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018537 (Pcgf2) NM_009545 polycomb group ring finger 2 Gene [Source:MGI (curated);Acc:Pcgf2-001]

 
Come back to gene ENSMUSG00000018537


For any suggestions or comments, please send an email to unitrap@crg.es