Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST298987
Clone ID OST298987
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST298987
Sequence
CTGAGCGTTTGAAAAATATTGTGCTGCCTCCTTCTGCCTACTGTGGTGTCTGAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 77103772..77103824 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042272 (Sestd1) NM_175465 SEC14 and spectrin domains 1 Gene [Source:MGI (curated);Acc:Sestd1-002]

 
Come back to gene ENSMUSG00000042272


For any suggestions or comments, please send an email to unitrap@crg.es