Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP0598
Clone ID AP0598
Vector pGT0lxr
Project sanger

Sequence tag AP0598
Sequence
TTTTTTTTCCAGTGTTGGCTGACTTACAGCTTCTCTAAAGTAGAGGCAGTTTCTGAACCTCAGGCTCCTGCCTCGCAGTT
CTGGCTTGTGAGCACCAATGCAAAGAACTGCCCGGAGCGAG
Sequence Type mRNA
Unitrap ID UNI1127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12312161..12312281 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es