Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0304
Clone ID AN0304
Vector pGT0lxr
Project sanger

Sequence tag AN0304
Sequence
AAGCAGGCGCTCAACGGCCTTTCTCAGCTCACCTACAGCAGTGGCAGCCCCACCAAGCGGCAGAGCCAGCTGGTGGATAC
TCTGCAGCAGCGAGTGAGGGATCTGCAGCAGCAGCTGGCTGATGCTGACAGACAGCACCAAGAAGTTATCGCTATCTACC
GGACACACCTCCTCAGTGCCGCACAG
Sequence Type mRNA
Unitrap ID UNI4817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60721873..60724234 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034485 (Uaca) NM_028283 uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:1919815]

 
Come back to gene ENSMUSG00000034485


For any suggestions or comments, please send an email to unitrap@crg.es