Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297811
Clone ID OST297811
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297811
Sequence
AGCTTGCCCCGTCTGGTGGGACCTACCGATATTTCAACCGTTGACACTTTTATATTTTCACTACATTTTATATTTTTATA
GACTATTNTATATTAAGGTTTTTCTAGATCCTGTACAACCTTTTATATAACAAGTTCTATTTTGTGTGCA
Sequence Type mRNA
Unitrap ID UNI22411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 90097405..90097548 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037410 (Tbc1d2b) NM_194334 TBC1 domain family, member 2B Gene [Source:MGI (curated);Acc:Tbc1d2b-001]

 
Come back to gene ENSMUSG00000037410


For any suggestions or comments, please send an email to unitrap@crg.es