Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297588
Clone ID OST297588
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297588
Sequence
GTGCTAGGTCCAGAACTGGTCCATGTCTCANAGAAGAACCTGTCAGAGATTGAGAATGTCCATGGATTTGTTTCTCATTC
TCATATCTCACCAATAAAGGC
Sequence Type mRNA
Unitrap ID UNI7562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31743258..31743357 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]

 
Come back to gene ENSMUSG00000022770


For any suggestions or comments, please send an email to unitrap@crg.es