Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297521
Clone ID OST297521
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297521
Sequence
CCAACTTTCTAGCGCATGAGAAGATCTGGTTTGACAAGTTTAAATATGATGATGCAGAAAGGAGATTCTATGAGCAGATG
AACGGGCCTGTGACCTCCGGCTCCCGCCAGGAGAATGGTGCCAGCGTGATCCTCCGAGACATTGCAAGAGCCAGAGAGAA
CATCCAGAAATCCTTGGCTGGAAGCTCAGGCCCTGGAGCCTCCAGTGGACCTGGTGGAGACCACAGTGAGCTCATTGTGA
GGATTACCAGTCTGGAAGTGGAGAACCAGAACCTTCGAGGCGTGGTGCAAGATTTGCAGCAGGCCATTTCCAAGTTGGAG
GCCCGGCTGAGCTCTCTAGAGAAGAGTTCACCTACTCCCCGAGCCACGGCCCCACAGACCCAACATGTCTCTCCTATGCG
TCAAGTGGAGCCCCCAACCAAGAAAGGAGCCACACCAGCAGAGGACGATGT
Sequence Type mRNA
Unitrap ID UNI22421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75726828..75731669 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]

 
Come back to gene ENSMUSG00000055762


For any suggestions or comments, please send an email to unitrap@crg.es