Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297475
Clone ID OST297475
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297475
Sequence
CTGGGAAGTGGCGGGCTTATTCGGAAATGNTTTGCCACTTGAGGCCTTTGAGGAGGNAAGCGCTGAGGACCACTCTGNNT
GATTAGAGGAGGGNCTGTTGNGCNTTGAGCTAATNTCAACTNGNTTTTCANATCTCANAACTGTANCATTNTATGGNTNN
AGGCAGGATNGGACAGCACCCCAGGGAANGGGTAAACGCCTTATTTTTTAACTTATTGACTATATGTCTAGTTGATTTAC
CTTTGAGGCAATAGAATGCAGAAAGTCCTGTAAGTTTGGATTATTCTCTCATAATGGTTGACACAGAAGCAGTAAGTACT
AACTTGAAAAACAATAGTTTCCAATTANTAAATTTAGNGAACATTNGTAATAAAGCAGTTGAAACCATTG
Sequence Type mRNA
Unitrap ID UNI22422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122717899..122721209 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046603 (D9Ertd402e) NM_001013405 Uncharacterized protein C3orf23 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q66JZ4]

 
Come back to gene ENSMUSG00000046603


For any suggestions or comments, please send an email to unitrap@crg.es