Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297436
Clone ID OST297436
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297436
Sequence
CGGACGGGACGCGCCATGAGCTTCAGGAGTGGTAGAAGGGCTTCCTCANTGACTGTCCCACTGGCCACTTGACCGTGAAA
AATTTCANGATCTAGGNCAACTTATTCCCCTACAGAGACACCTCCAAGTTCACTGAACATGTCTTCCACATGTTTGACAC
CAACAGTGACAGNACCATCGACTTCTGAGTGTTCATCATTGCTCTTAGCATGACCTCTCAGGAGAAGCTGGAACAGAAGC
TCANGTGGGCCTTCAGNATGTCCGACCTANACAGCAATGGCCACATCAGCTGCAGTGAAATTCTGGAGATAGTGCAGGTA
CCTGCACTTGACAGGGCCTGGAGCATGGGGAGTGCAGGGATCCAGGACCCCCATCCCCGGCCCCATACACCAGGTCATTC
CTCTGCC
Sequence Type mRNA
Unitrap ID UNI9679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17940259..17940652 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  

 
Come back to gene ENSMUSG00000079167


For any suggestions or comments, please send an email to unitrap@crg.es