Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST297388
Clone ID OST297388
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST297388
Sequence
CGTGCGTTGGGTGGAAGAATTAACAATACCCGAACCTCTGAATTGCCCAAAGAGAAAACTCGATCCGAGGTCATCTGCAG
CATACGGTTTTTAGATGGCTTGGTACAGACCTTTAAAGTTAACAAACAAGATTTGGGCCAGTCGCTTCTGGATATGGCCT
ATGGCCACCTGGGTGTGACGGAGAAGGAATACTTCGGCTTGCAACATGGCGACGACCCAGTGGACTCTCCTAGATGGCTT
GAGGCAAGCAAACCCCTCAGGAAGCAGCTGAAAGGTGAGTATGCTCTTGCTTCACTTGGTCGCTGGGTGTACGGCAAACT
GTCTTCTCCTTATGGGGGACTTAAGGTGGCGGTGGGGTCAGGGGGAGGCG
Sequence Type mRNA
Unitrap ID UNI18585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57277644..57283017 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es