Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0809
Clone ID AM0809
Vector pGT0lxr
Project sanger

Sequence tag AM0809
Sequence
CACCCGGAAATGATTGTGGAGGAACATGGCGTTGCTGGTGCGAGTCCTTGTCCA
Sequence Type mRNA
Unitrap ID UNI4822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155755747..155755797 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es