Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0784
Clone ID AM0784
Vector pGT0lxr
Project sanger

Sequence tag AM0784
Sequence
TTTTTTTTTCCGAACGGTGTCGCAGACCGGAGTGGCTGTGCCTCGTCCGCACTTGCCAGGGCGGCCCTCATGGCGCTGTT
CCGACGCCCGACG
Sequence Type mRNA
Unitrap ID UNI4823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70269224..70269308 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032218 (Ccnb2) NM_007630 cyclin B2 Gene [Source:MGI Symbol;Acc:MGI:88311]

 
Come back to gene ENSMUSG00000032218


For any suggestions or comments, please send an email to unitrap@crg.es