Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0770
Clone ID AM0770
Vector pGT0lxr
Project sanger

Sequence tag AM0770
Sequence
AGCTCACCTCCACTATTATGAGAGAACCGAAAAGGTTACAGGCCTGAAGATAGCTTCATGAGTGTCTATACGATGCAGGC
AGAACACCATCAAATGCCTCTGGATTATAATCGGCGTGGTACAAGCCTAATGGAAGATGATGAAGAGCCAATTGTTGAAG
ATGTTATGATGTCCTCAGAAGGAAGGATTGAGGATTT
Sequence Type mRNA
Unitrap ID UNI4824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39619344..39622642 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025862 (Stag2) NM_001077712 stromal antigen 2 Gene [Source:MGI (curated);Acc:Stag2-002]

 
Come back to gene ENSMUSG00000025862


For any suggestions or comments, please send an email to unitrap@crg.es