Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0758
Clone ID AM0758
Vector pGT0lxr
Project sanger

Sequence tag AM0758
Sequence
CCTTTACCAAGTCGTTATAGAATGGGCTCTAGAGATACACCCGAGCTCGTTGGTTATCCATTACCACAAGCGTCTTCTTC
TTACATGCATGGAGGCAGTCCGTCGCGCTCCGTTGTAATGGTTAGTGGATTACATCAGCTCAAAATGAATTGTTCAAGAG
TCTTCAACCTGTTCTGCTTGTATGGAAATATTGAAAAG
Sequence Type mRNA
Unitrap ID UNI4825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80437932..80438129 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024095 (AC122253.5) NP_659051 Heterogeneous nuclear ribonucleoprotein L-like [Source:UniProtKB/Swiss-Prot;Acc:Q921F4]

 
Come back to gene ENSMUSG00000024095


For any suggestions or comments, please send an email to unitrap@crg.es