Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0759
Clone ID AL0759
Vector pGT0lxr
Project sanger

Sequence tag AL0759
Sequence
TTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATCTCCGGATAACTGAGGCGTTTCTGTACATGGATTATCT
G
Sequence Type mRNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114584824..114584904 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es