Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST296516
Clone ID OST296516
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST296516
Sequence
TTCTCCGATACCCTAATCCGGNTCACAGAATGGTTAAAGCAGCTTTAAGTAGAGAGNGGATTATTTTCCCCTCAGTTTGT
CTTCTGTTTGCGGCTCTGAAAGAATGTTGTGGGCGCTCTTTTTCCTGGNGACTACCTATTCACGCTTGAACCTCTGCCAT
CCAGATGCAGAAAATGCCTTTAAAGTAAGACTTAGCATCAGAGCAGCTCTTGGAGATANAGCATATGTCTGGGACACCGG
ATCAAGAATACCTCTTCAGAGCAATGGTGGCATTCTCCATGAGAAAAGTTCCCAACAGAGAAGCAACAGAAATTTCCCAT
GTCCTGCTTTGCAACATAACCCAGAGGGTGTCGTTCTGGTTTGTGGTCACGGACCCTTCCAACAATTATACTCTTCCTGC
AGCTGAAGTACAGTCGGCCATAAGAAAGAATAGGAACCGGATCAACAGNGCATTTTTTCTGGATGACCATACTCTGNAAT
TTNTAAAAATTCCTTCTACTCTTGCTCCC
Sequence Type mRNA
Unitrap ID UNI22459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160528102..160546341 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015401 (Tmem27) NM_020626 transmembrane protein 27 Gene [Source:MGI (curated);Acc:Tmem27-001]

 
Come back to gene ENSMUSG00000015401


For any suggestions or comments, please send an email to unitrap@crg.es