Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST296472
Clone ID OST296472
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST296472
Sequence
GACTGAGGGTCATCTGGGGAGATGCTCGCAGCAGCTGGCTCTGCAGGGAAAACTGACTTCATTTTCCCCGAGGCTGTATT
CAAAACCTCCCAGAGGGTTTGAGAAGTTTTTTAAGAATAAGAAGAACAGAAAAAGTGCAAGCCCAGGAAATTCAGTACCT
CCAAAAAAAGGTAAAACCGTTCCATTTGATAAGTCAGACTGTCATGTTTTACAGTTGAGTATTTTTACTTTATTGTAAAT
GATTTACCTTTAGTATAAATATTAGCAGTGAATTAATCTGGTGGCTGTATTTTTTACCTTACGCTAGTCCTCAAAAACCA
CAGAGAGAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16973

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126004247..126005212 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031967 (Afg3l1) NM_054070 AFG3(ATPase family gene 3)-like 1 (yeast) Gene [Source:MGI (curated);Acc:Afg3l1-001]

 
Come back to gene ENSMUSG00000031967


For any suggestions or comments, please send an email to unitrap@crg.es