Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST296440
Clone ID OST296440
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST296440
Sequence
ACTGAGCATGCCCCAGGNATTTGTCTGAGGCCTTGANGGAGGCCACCAAGGAGGTACACATCCAAGCCGAGAATGCTGAG
TTCATGAAGAACTTTCAGAAGGGTCAGGTGTCCAGAGAAGGCTTTAAGCTGGNGATGGCTTCCTTGTACCATATCTACAC
GGCCCTGGAAGAGGAGATAGAGCGCAACAAGCAGAACCCAGTCTATGCCCCACTCTACTTCCCTGAGGAGCTGCACCGNA
GGGCTGCCCTGGAGCAGGACATGGCCTTCTGGTATGGGCCTCACTGGCAGGAAATCATCCCTTGCACGCCAGCCACACAG
CACTATGTAAAGCGTCTCCACGAGGTGGGGCGCACTCACCCTGAGCTGCTGGTGGCCCACGCATATACCCGCTACCTGGG
TGACCTCTCAGGGGGTCAGGTCCTGAAGAAGATTGCACAGAAGGCCATGGCCTTGCCCAGCTCTGGGGAGGGCCTG
Sequence Type mRNA
Unitrap ID UNI8102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77619753..77621096 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005413 (Hmox1) NM_010442 heme oxygenase (decycling) 1 Gene [Source:MGI Symbol;Acc:MGI:96163]

 
Come back to gene ENSMUSG00000005413


For any suggestions or comments, please send an email to unitrap@crg.es