Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST296194
Clone ID OST296194
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST296194
Sequence
CTTCCCCCAGGCCCTACCTGGNGCCCTTCTGGGAGGGGCATCCTCTTTGATACCCTGAAGACCAGCTCTGGACCTTNCTA
CAAAAGTGNCTCCCANGACCGCTTAACCAAAGGACGGATTCTTGGGACATCCCCCAATCCACCTGGNCCCTCCGGCATAG
GGAGGGGGACCCATCAAGACTAAAGNTGACTAACTTGGGACTTGCAGCTCCAGGGACAGAAGGGGGTGGNGGAGGCTATC
AAGATCTTTTCCCGACCCAAAGTCTTTGTGAAGATGGATACCTAGTCCTTCCCCGCTTGGTACCCACCAAGAGTAACAGG
GAGATATGTGTGCGGATCACCACGTGGCTGCCAAGGGCAGACTCAAGCCCTGTCATAGCTCAAAGACAGGAGCGTTGGGG
TGGGCAGAATCGAAAGCACTTCTTAGTCACCAGGGGCTGCAGAAGGNCCACCAGCCTCCCCAA
Sequence Type mRNA
Unitrap ID UNI22471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108227586..108227814 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013155 (E130303B06Rik) NM_198299 RIKEN cDNA E130303B06 gene Gene [Source:MGI Symbol;Acc:MGI:2142593]

 
Come back to gene ENSMUSG00000013155


For any suggestions or comments, please send an email to unitrap@crg.es