Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST296127
Clone ID OST296127
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST296127
Sequence
ATTGGCTGAGTGGTTTCCATGGAGATTGTCTCACTTTGACAAAGATTATTGAAGCAAGATTAAAGATGTACAAGCATTCC
AATAACAAGGCCATGACAACGGGGGCGATTGCTGCAATGCTGTCTACCATCCTGTACCTCACGGCGCTTCTTCCCTTACT
ATGTTTACAACATCATTGGAGGACTTGATGAAGAAGGAAAGGGAGCTGTGTACAGCTTTGACCCAGTGGGCTCTTACCAG
AGAGACTCTTTCAAGGCGGGAGGCTCAGCAAGTGCCATGCTGCAGCCTCTGCTCGACAACCAGGTTGGCTTCAAAAATAT
GCAGAATGTAGAGCACGTNCCCCTGACGCTGGACAGAGCCATGT
Sequence Type mRNA
Unitrap ID UNI22473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15613110..15630127 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014769 (Psmb1) NM_011185 proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

 
Come back to gene ENSMUSG00000014769


For any suggestions or comments, please send an email to unitrap@crg.es