Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST295116
Clone ID OST295116
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST295116
Sequence
CTGGGACCTACGGGCAGCCATTGTCCTGTGCCNTCAGCTGGNATGNGGNCAGGCTNTNACAGCCNCGGGAGAGGCCCACT
TTGGCCCAGGCCGAGGCCCAATCCTCTTGGACAATGTCAAATGCCGAGGAGATGAGAGCACCTTGCTACTGTGCTCTCAT
ATCCGCTGGGATGTCCACAACTGTGACCACAGCGAGGATGCCAGTGTCTTGTGCCAGCCATTGTGACCCAGATGGCTCTG
TACTCCATACCATATCAAAGGAGCCTATGAGGAACTGCCTGTCCTTTCCCAGGATGCCTT
Sequence Type mRNA
Unitrap ID UNI19912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136436688..136436987 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es