Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST295107
Clone ID OST295107
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST295107
Sequence
GACCTTGGTCCAAAAGAAGTCACAGCGTCTCCAGAAACCCTTACGGGTTGACCTTGCCCTTGAGAATCATTCTAAGATCC
CTGCTCCCAAAGACATCCTCGCACATCAGGTCCCTAATGCCAAGAAGCTCAGGCGAAAGGAGGAGTTATGGGAGAAACTG
GCAAAGCAGGGCGAACTGCCCAGGGATGTGCGCAAGGCACAGGCCCGACTCCTTAGCCCTCCCACACCAAAGGCCAAACC
TGGGCCCCAGGACATCATTGAGCGACCCTTCTATGACCTCTGGAACCCAGACAACCCTCTGGACACGCCTTTGATTGGTC
AGGATGCATTTTTTCTGGAACAGACCAAGAAGAAAGGCGTGAGGCGGCCACAACGCCTCCACATCAAGCCTTCCCAGGTG
CCTGCAGTGGAGGTGATTCCTGCAGGAGCCTCCTACAACCCAACCTTTGAAGATCACCAGGTG
Sequence Type mRNA
Unitrap ID UNI5066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16525485..16528230 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041560 (Gltscr2) NM_133831 glioma tumor suppressor candidate region gene 2 Gene [Source:MGI Symbol;Acc:MGI:2154441]

 
Come back to gene ENSMUSG00000041560


For any suggestions or comments, please send an email to unitrap@crg.es