Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST294890
Clone ID OST294890
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST294890
Sequence
CTTTTTTGCACTCTCTGGGCTGGNTATGCTGGACTCCTTGGATGTGGTGAACAAAGACGATATAATAGAGTGGATCTACT
CCCTGCAGGTTCTTCCCACAGAAGACAGCNATCTATATGGNGGNTGCTCACAGACATCTAT
Sequence Type mRNA
Unitrap ID UNI3186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46434243..46434350 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024477 (Pggt1b) NM_172627 protein geranylgeranyltransferase type I, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1917514]

 
Come back to gene ENSMUSG00000024477


For any suggestions or comments, please send an email to unitrap@crg.es