Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0169
Clone ID AH0169
Vector pGT0lxr
Project sanger

Sequence tag AH0169
Sequence
GCTCTCATTTTACTGAAGTAGAGCGGGTCCCCAAGGCCCTGGAAGTGACCGAGAGTCCCTTGGTGAAGGCCGTCTTC
Sequence Type mRNA
Unitrap ID UNI4849

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82026671..82028072 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es