Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0051
Clone ID AH0051
Vector pGT0lxr
Project sanger

Sequence tag AH0051
Sequence
GGAATATTTAAAAAAAAACCCAAAAAAAACCAAAAAACAAAAAACCAACCCTTTTGTAGCCGTTGGAAGCTTCATGTCCT
TTATTATAACTTGTCTTCTCCAGCGGAAGTGACCGCGGTGGCTTCAATAAATTTGGTGGTCCCAGGTCGCAGAAACCAAA
GAAGAAG
Sequence Type mRNA
Unitrap ID UNI4853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135117811..135117950 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030795 (Fus) NM_139149 fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI (curated);Acc:Fus-007]

 
Come back to gene ENSMUSG00000030795


For any suggestions or comments, please send an email to unitrap@crg.es