Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST293266
Clone ID OST293266
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST293266
Sequence
GACTGAGAATTTGCAACAGCATGAATCAAGGAAAAGTTAGCCAAACTTCAAGCTCAGGTCCGGATAGGGGGCAAGGGTAC
AGCTCGCAGGAAGAAGAAGGTGGTACATAGGACAGCTACCTGCTGATGACAAAAAGCTTCAGAGTTCACTAAAGAAACTG
GCTGTGAACAATATAGCTGGTATTGAAGAGGTGAATATGATTAAAGACGATGGCACGGTTATTCATTTCAACAATCCCAA
AGTCCAAGCTTCCCTCTCCGCTAACACCTTTGCAATTACTGGTCATGCAGAAGCCAAACCAATCACAGAAATGCTTCCTG
GGATATTAAGTCAGCTTGGTGCTGACAGCTTAACGAGCCTTAGAAAGTTAGCTGAACAGTTCCCACGGCAAGTATTGGAT
AGTAAAGCGCCCAAACCAGAAGACATCGATGAAGAGGATGATGATGTTCCAGATCTTGTAGAAAATTTTGATGAAGCATC
GAAAAATGAAGCTAACTAAAATGA
Sequence Type mRNA
Unitrap ID UNI16181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108489442..108503188 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es