Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST292943
Clone ID OST292943
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST292943
Sequence
GACTGAGCTTCCGGGTGACCTGCATGGGTTCCTGTGGGGTCTCCACCAAGGCCAANGATGGGGCATGGGTGGTGGAGGAG
AGCTACTTCAACAGCATCCCTGTCACTGGCTGACAAGGGAAGTCTGCCTGGCGTGGAGAGCACAACATTCCCTTTTCAGT
TCCTGCTTCCTGCCACAGCACCCACATNTTTTGAGGGACCCTTTGGGAAGATTGTACACCANGTGAGGGCGTNCATCGAC
ACTCCACGTTTTTNCAAGGATCACAAATGTAGCCTCGTGNTCTACATNCTGAGCCCNTTGNACCTGAACAGCATCCCAGA
TATTGAGCANCCCAATGNGGCCTNCACTACCAAGAANTTCTCCTATAANCTGGTGAAGACTGNCAATGTGGTTCTCACAG
CTAGCACTGACCTTCGTGGCTATGTGGTGGNACAGGTGCTGCGGATGCAGGCTGACATTGAGAACCAGTCAGGC
Sequence Type mRNA
Unitrap ID UNI22535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24782101..24783361 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026972 (Arrdc1) NM_178408 arrestin domain containing 1 Gene [Source:MGI (curated);Acc:Arrdc1-001]

 
Come back to gene ENSMUSG00000026972


For any suggestions or comments, please send an email to unitrap@crg.es