Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0627
Clone ID AF0627
Vector pGT0lxr
Project sanger

Sequence tag AF0627
Sequence
GTCCTAACAGAAACATCGTACACAAGGGCTGTAGATTGGTGGGGCCTTGGTGTACTCATATATGAGATGCTCGTCGGCGA
G
Sequence Type mRNA
Unitrap ID UNI4858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142461867..142461947 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004591 (Pkn2) NP_848769 protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

 
Come back to gene ENSMUSG00000004591


For any suggestions or comments, please send an email to unitrap@crg.es