Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0622
Clone ID AF0622
Vector pGT0lxr
Project sanger

Sequence tag AF0622
Sequence
CTGACTGACTTCGGCTTGTCTAAGGTGGGATTAATGAGCATGACCACCAATCTCTATGAAGGCCACATAGAGAAGGACGC
TCGAGAGTTCTTAGATAAACAG
Sequence Type mRNA
Unitrap ID UNI4859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103560803..103560904 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]

 
Come back to gene ENSMUSG00000034751


For any suggestions or comments, please send an email to unitrap@crg.es