Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST292437
Clone ID OST292437
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST292437
Sequence
GACTGAGGAATTGATTTCAAGATCCGACCGTGGNCATAGAGGGGAAGAGGATCAAACTGCAAGTGTGGGACACGGCTGGC
CAAGAACGATTCAAGACAATAACTACCGCCTATTACCGTGGAGCCATGGGCATTATCCTCGTATATGACATCACAGATGA
GAAATCCTTCGAGAATATTCAGAACTGGATGAAAAGCATCAAAGAGAATGCCTCTGCGGGAGTGGAGCGCCTCCTGCTGG
GAAACAAGTGTGACATGGAGGCCAAGCGGCAGGTGCAGAGAGAGCAGGCGGAGAAGTTGGCTCGAGAGCACAGAATCCGA
TTTTTTGAGACGAGTGCCAAATCCAGTGTGAATGTGGATGAGGCTTTCAGTTCCCTGGCCCGTGACATCTTGCTCAAGAC
AGGAGGCCGGAGATCGGGAACCAACAGTAAGCCCTCAAGCACTGGCCTGAAAACATCTGACAAGAAGAAGAACAAGTGCT
TGTTAGGCTTGGG
Sequence Type mRNA
Unitrap ID UNI18120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90027448..90029503 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027935 (Rab13) NM_026677 RAB13, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab13-002]

 
Come back to gene ENSMUSG00000027935


For any suggestions or comments, please send an email to unitrap@crg.es