Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0277
Clone ID AF0277
Vector pGT0lxr
Project sanger

Sequence tag AF0277
Sequence
GAACGGTTCACACCAGTGCCTTCTCTACTCTTCAATGGTGTGTTGTCCCTGGTCTACCTGTGTGTGGAGGACATCTTCCA
GCTCATTAACTACTATAGCTTCAGCTACTGGTTCTTTGTGGGCCTTTCTATTGTGGGTCAGCTTTATCTACGCTGGAAGG
ACCCCGACCGGCCTCGCCCTCTCAAG
Sequence Type mRNA
Unitrap ID UNI4862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54992624..54993561 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es