Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST292116
Clone ID OST292116
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST292116
Sequence
GCAGAGCAGTCCTTCTTGTATGGAAACCATGTGTTGAAATCCGGTCTGGGTCGAATTACTGAGAACACATCTCAGTACCA
GGGAGTGGTTGTCTATTCCATGGCTGGACATTCCTCTGGGTTTTGGGGTGGCAGCATAGTCTACCCAAGACTGCCGAAAN
GTGGACCCCATGGCAATTGTGGTGTTCCACCAAGCANACATTGGNGAGTACGTACGCCATGAAGAGACACTGACTTANGA
CGGTCATTNCAAGAACATTTTGNTGTGNGAGAGGACTTAGCTTTGTTTGCTGTGTGCGGACATCAAANTNAATCTGGACN
ACACTGAGANACCCAACCTTGGNNTCTTATCANCANAAANGGCGNGCANNCANGGGNTNTGGNCNTCTAGAGTCAAAAGC
AGNTGGATCACAAGTATAAGGCCNGNTCAGGCTACTTGGAGAGGTCAAGGCTAGCCTGGGCTACATAGCGGAG
Sequence Type mRNA
Unitrap ID UNI17883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109581971..109582625 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031917 (Nip7) NM_025391 nuclear import 7 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913414]

 
Come back to gene ENSMUSG00000031917


For any suggestions or comments, please send an email to unitrap@crg.es