Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0727
Clone ID AE0727
Vector pGT0lxr
Project sanger

Sequence tag AE0727
Sequence
GGATTGTTTTTTAGTTTGTAATTCAAAAGTGACTGGTGTGGCGGATTGGCTTGGCCGATTGGCCTGGCGAATTGGCCTGG
CTCCGACGTTTTGCGGCGCGAGCCCTTGAGAGGACGCGGGTCTCGTCACCCTGCCTGCTGCCTTTGCATCCCTTCCTGTG
CGGACCACCATGGACGTGCAGGCGCAG
Sequence Type mRNA
Unitrap ID UNI4867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27054056..27054230 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]

 
Come back to gene ENSMUSG00000024301


For any suggestions or comments, please send an email to unitrap@crg.es