Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0726
Clone ID AE0726
Vector pGT0lxr
Project sanger

Sequence tag AE0726
Sequence
GGGTTTTTTAAAAGGGTTTTTTTTTTTTTTTTTCTCAAGAACGGTTCACAGGGAGCACAGGAGTGCAGGTCCTGACACAG
GAGCAGCTGGCTAATACTGGGGCCCAATGCCTGGATTAAAAAG
Sequence Type mRNA
Unitrap ID UNI4868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91481220..91671710 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es