Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST291576
Clone ID OST291576
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST291576
Sequence
AATAACAAGGCTTTTCTCCAGGGTCCAGAAGTTGGACCCGAGGTGTTTTTTGCACATGAGTGTTCAAGCGACTCAGAACA
GTCAGGTTCCAGCTGAGCGTCCCAGAACTGTTTCCCGCACCAGTGACAGTGACCCGGCTAAGCATGGGGAGCAGCATGAG
GGTCAGCACTACAGCATCCCCCTCCAGGATCTGAAGACAGTGTTTCCTCACGGCCTGCCTCCTCGGTACATGATGCAGGT
GAAGACTTTTGGCGAAGCTTGTCTGATGGTCAGGAAGCCAGCTCTCGAGCTTCTGGGCTACCTGAAAAATACCAATTTTG
CTCATCCAGCTGTGCGATATCTTCTTTATGGGGAGAAGGGGACAGGAAAGACCCTCAGTCTCTGCCATGCTGTTCATTTT
TGTGCAAGACATGACTGGCTGATTCTGCATATCCCAGATGCTCATCTTTGGGTAAAAAACTGCCGGGAG
Sequence Type mRNA
Unitrap ID UNI18298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88733420..88746727 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es