Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST291567
Clone ID OST291567
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST291567
Sequence
GACTGAGGGGTCCCTTCAGTGTTGTACGGCGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTAAAAATTGTTGAT
GTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAGCGNNAAGCCAGNATCTGTCATATGCTGANGCA
TCCACACATTGNNNAGCTGNTGGAGACATATNNNTCAGATGGNATGCGTTTACATGGTTCTTGAATTGAGAGT
Sequence Type mRNA
Unitrap ID UNI22562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 13291786..13363177 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031012 (Cask) NM_009806 calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI (curated);Acc:Cask-001]

 
Come back to gene ENSMUSG00000031012


For any suggestions or comments, please send an email to unitrap@crg.es