Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST291496
Clone ID OST291496
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST291496
Sequence
GACTGAGGATGAATGACATGAACTTGAGCCCAGTGGGGATGGAGCAGCTGTCTTCATCCTCTGTGAGCAATGCCCTGCCA
GTCTCAGGAAGTCACCTGGGCTTGGCTGCCTCTCCCTCTCACAGTGCCATCCCTGCCCCAGGACTTCCAGNGGCAATTCC
AAACCTGGGTCCCTCCCTGAGCTCTCTGCCTTCTGCCTTGTCTCTTATGCTCCCCGTGGGCATTGGAGACCGAGGAGTGA
TGTGNGGGCTACCTGAGAGGAACTACACCCTACCTNCACCTNCTTACCCTCACCTAGAGAGCAGNTACTTCAGAACCATT
CTACCTGGCATTTTATCTTATTTAGCTGACAGACCACCTCCTCAGTATATCCACCCCAACTCTATAAATGTTGATGGAAA
TACAGCATTATCTATCACCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 85370719..85375718 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035529 (Prdm4) NM_181650 PR domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1920093]

 
Come back to gene ENSMUSG00000035529


For any suggestions or comments, please send an email to unitrap@crg.es