Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0149
Clone ID AE0149
Vector pGT0lxr
Project sanger

Sequence tag AE0149
Sequence
GCAGGATGATAAAGAGTTTGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGCCTGCCATGGTGG
TGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCCGGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCT
GAG
Sequence Type mRNA
Unitrap ID UNI4871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153493237..153493398 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]

 
Come back to gene ENSMUSG00000027478


For any suggestions or comments, please send an email to unitrap@crg.es