Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290907
Clone ID OST290907
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290907
Sequence
TGAGGCTCTCCTTGGNCATTCCTGTACTCTTTGTAGGCTCCACATCAGGTTGCAACTCAGAACTATTGTGAACTTCAAGA
AATAGGAAGATCCAAGTGACACAGCCACACCTCTACAGAACAGCCGTGTGCGGCCTCTGAGGCTCCACAGGAGGGCACGT
CTCACTGCATCTTCATGCGTTGACCAGGCCAATTTCATAGTTGCAGCCTTGCTAGTGAGGACCTATAGGCAGCTCCCAAG
ATGGGTGAAAGGAAAGGCCAGAACAAGTACTACCCCCCAGACTTCAACCCCGAAAAGCATGGCTCTCTCAACCGATACCA
CAACAGCCACCCACTTCGAGAACGGGCTCGGAAGCTCTCACAAGGCATCCTTGTTATCCGATTTGAAATGCCATACAACA
TCTGGTGTGACGGCTGTAAGAACCACATCGGCATGGGTGTGCGCTACAATGCAGAAAAGAAGAAGGTTGGCAAT
Sequence Type mRNA
Unitrap ID UNI22589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86785663..86790975 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004994 (Ccdc130) NM_026350 coiled-coil domain containing 130 Gene [Source:MGI Symbol;Acc:MGI:1914986]

 
Come back to gene ENSMUSG00000004994


For any suggestions or comments, please send an email to unitrap@crg.es