Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290599
Clone ID OST290599
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290599
Sequence
GCTGCTCCCAGCTGCCTGGTCTTGAGTACCANCNTGGCCAAACCTTACGAANTTAACTGGCAGAAGGAAGTGCCCTCTTT
CTTGCAAGAAGGAGCAGTTTTTGACAGATACGAAGAGGAATCTTTNGNGTTTGAGCCCAACTGCCTCTTCAAAGTAGATG
AATTCGGCTTCTTCCTGACGTGGAAGAGTGAAGGCAAGGAAGGACAAGTGCTAGAATGTTCCCTCATCAACAGTATTCGC
CAAGCAGCCATACCAAAGGATCCCAAAATCCTGGCTGCTCTCGAAGCTGCTGGAAAACCTGAAAATGANCTGGAAGGGCG
GATATTGTGTGTCTGCAGCGGCACGGATCTGGTGAATATCGGNTTNACTTACATGGTGGCTGAAAATCCAGAAGTAACTA
A
Sequence Type mRNA
Unitrap ID UNI16552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135631324..135735979 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es