Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290596
Clone ID OST290596
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290596
Sequence
ACTGAGAGCCCTTGCTTAGGCACATGCACGTGGCTTCAGAGATTGTGGTCCCCACAGTCTGCGCCCTCTCCATCCTCACT
GCTGCCCTGATGCTGACACTTCTCCTCAGGAGACGTGGCTGAGACGGGATCTCCTCTCCACCTTCATCTGTCAAAGCATC
TCTTCAGGATCACTCTTCTTTTCTGCTGCAGAAGTTCACGTGATGTCTATTTTTCAGGCTCTGAAAATTAACTCACTCTT
TTCCCCCTTTTTGTTTTGTGCTGTGATTTAAGAAAATAAAAA
Sequence Type mRNA
Unitrap ID UNI22598

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63985611..63985888 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es